>>40542065
>>Attack
Hokuto no Kobold

>>40542065
>Attack

>>40542065
>Attack
Climb up onto its back

>>40542065
>sweep the leg

Rolled 77, 75 = 152 (2d100)

>>40542065
Attack it is. Gimme dice!

Rolled 24 (1d100)

>>40542249

>>40542249
Jesus fuck, Owlbear, get it together.

Rolled 20 (1d100)

>>40542249
BLOOD FOR THE BLOOD GOD!

Rolled 86 (1d100)

>>40542249

>>40542249
Writing!

>>40542249
I forgot this was roll under.
That was a scary moment.

Rolled 26 (1d100)

Defensive rolls.

Rolled 64, 60 = 124 (2d100)

>>40542484
Well, since I don't take malformed dice from players, it wouldn't be fair if I excepted myself.

>>40542511
By which I mean, I want you to roll a d100 for Nadia's defense, best of three. In case I was unclear.

Rolled 37 (1d100)

>>40542552

Rolled 12 (1d100)

>>40542552
Papa needs a new pair of tongs

>>40542571
Nadia don't take no shit

Rolled 26 (1d100)

>>40542552

>>40542589
And I get new tongs!
Yay!

>>40542065
here's only one thing you can do. You're not a smart girl. You know your limitations. You also know what you are.

Loyal.

And as the creature decides that Emma would make an easier snack than you, there's only one recourse. You crouch down and you seem to glide forward across the ground in slow-motion, bits of detritus kicked up in your wake. Your first punch strikes a glancing blow along it's side, and you feel your fist sink into toe monster's flesh. It roars as you stop short, spinning on your right paw, tail sweeping an arc behind you as you bring your left fist into the bear's stomach, almost exactly opposite the impact of your first blow.

The creature gives a pained snarl, recoiling clumsily from you back onto all fours, rounding to face you. It looks injured. Froth gathers around the corners of its beak, and it pants heavily, trying to keep its attention focused on you and Emma. It circles around the outside of the domain, and you circle around it. Emma follows your lead, moving behind you. You hear her whispering as the three of you move in concert - the familiar, if unintelligible - chant of her invisibility spell.

The small girl vanishing spurs the creature into action. It lumbers toward you, huffing heavily, and pulls back on its rear paws, raking heavily at you. You dance backward, easily evading the monster's assault. You don't know what you were so afraid of! These things seem scary, but they're so simple! They attack mindlessly, all pissed-off feathers and smelly fur. It's actually kind of fun!

The beast falls back to all fours, panting heavily from the assault. It trembles and retches, whatever it had managed to eat through the pain of the bee's assault now lying on the forest floor.

It seems the time's come to wrap it up. It seems barely able to stand now.

>Finish it. Time for dinner.
>Let it go. It put up a good fight.
>Other

Rolled 6 (1d100)

>Other

I try to seduce the beast with a well placed diplomacy check.

>>40542716
The beast has no concept of diplomacy, and this is not one of your Japanese animes.

>>40542712
>>Finish it. Time for dinner.
A monster is most dangerous when they're wounded, and we need those supplies

Rolled 38 (1d100)

>>40542741
>Attack

Well, bollocks! Looks like my brilliant plan had no effect. The beast's tiny brain cannot fathom my beauty. Time for Plan B. Pointy stick in the eye!

>>40542712
>Finish it. Time for dinner.

>>40542712
>>Finish it. Time for dinner.

Rolled 80 (1d100)

>>40542712
>Attempt to convert it to your religion, thats how paladins work right?

Dice, please.

Rolled 70 (1d100)

>>40542886

Rolled 4 (1d100)

>>40542886
FINISH IT

>>40542901
I think you finished it

>>40542901
Well looks like it's pretty fuck'n dead.

Rolled 76, 68 = 144 (2d100)

>>40542886
A bear there was, a bear, a bear!

Rolled 71 (1d100)

>>40542886
Damn, I completely fucked up that one.

>>40542931

Rolled 51 (1d100)

>>40542886

>>40542712
You approach the owlbear calmly, your tail swishing side to side, sweeping the air. You crouch down in front of it as the creature regards you quietly, malice in its yellow eyes. You smile sweetly.

"Hey. I don't know if you understand me, but you did a good job. It was a good workout, so thanks."

"What are you doing?" you hear Emma hiss softly from somewhere nearby.

You reach out slowly as if to pet the creature, and it snaps weakly at your hand. You jerk your paw back, out of the creature's reach, and shake your head softly. "I guess we're done, then." You dart forward, pressing your torso against the beast's shoulder and wrapping your arms around its neck. You tighten your grip and grit your teeth, narrow your eyes, and give a low shout of effort. The beast thrashes, but in its weakened state is unable to break your grip. It tries to slash at you, but can't quite reach you. You strain against the beast's knotted musculature for several minutes, moving with it as it thrashes about in it's final moments before, with a wrench, you jerk its head to the side, snapping its neck cleanly.

The monstrous corpse falls to the forest floor, twitches twice, then falls forever still. A minute passes before the barrier falls, Nurrim clapping as she steps into the clearing.

"Oh my! Very, very nicely done, both of you! Emma, good aim and perfect timing! Your illusions were superb! Nadia, you... you're a more adept fighter than I'd thought was possible at your age! Who taught you?"

You shook your head, whining softly as Emma releases her illusion, reaching up to gently touch your arm, giving a slight whine of concern at the congealing blood. "Hey... Nadia, are you all right?"

>>40542998

You look between the two sisters, ears pricked forward. You muss Emma's hair.

"Nobody, really. I just... maybe know how because?"

"Oh? Well well... I never thought I'd see a case of actual genetic memory in my lifetime."

She moves to the corpse, considering it carefully before taking a seat on it and crossing one leg over the other.

>Genetic memory?
>So how do we get this home?
>Will there be more of them?
>Other

>>40543017
>Genetic memory?
>So how do we get this home?

File: 0981234.png (95 KB, 377x250)

95 KB PNG

>>40543017
>Genetic memory?
>So how do we get this home?

>>40543017
>Genetic memory?
>So how do we get this home?

>>40543017
>Genetic memory?

Also I wonder how the whole reincarnation thing would fuck with genetic memories. Would it result in really confused children or absolutely no difference?

>>40543017
>Genetic memory?
>So how do we get this home?

>>40543017
"What's that genetic thingy?" You sit cross-legged in front of her, looking up as your tail settles behind you. Emma whimpers at being ignored, licking at her hand and trying to scrub your arm clean as her tails flick about.

"As I understand it, sometimes a monster is born with the collective memories of the whole race. These individuals tend to be special, capable of achieving great things with their lives. I'm not certain if there's any truth to it, mind you, because by all accounts it's so rare as to not exist... but here before me I see a pup who can fight like a warrior three weeks out of the womb."

You blush lightly at the praise. At least, you think it's praise. It could also mean she thinks you're some kind of freak, but then again, she doesn't sound accusatory. Or does she? You whine softly and shake your he- OW! "Emma, careful!"

She whines softly, pulling her hands back quickly. "I'm sorry!"

You shake your head and pull her into a hug, frowning at the crimson staining her hands.

"So... how are we getting this home?"

"We don't. Not all of it, anyway."

===========================================

"Every time I let you out of my sight, you get hurt..." Djanna grouses, pouring water over your wounds and scrubbing bits of grime and debris out of them. You whine and try to jerk out of her grip, but as strong as you are, the dragon girl is having none of it. You resign yourself to her ministrations as Nurrim instructs you all on proper butchering techniques.

"Then you make an incision from the neck down, pull out the entrails..."

Emma looks like she's about to pass out, and her cheeks have a sickly pallor to them. Djanna is only half paying attention, but you're fascinated. As the elder kitsune pulls the entrails out, letting them spill on the forest floor, you think you see a few deeply bruised spots. Was that where you hit it? Wow...

>>40543408
"...armor. I mean, if you're going to be getting up close and personal- Nadia, are you listening to me?" Djanna gives you a light swat on the shoulder, and you turn toward her with a yelp.

"I am, I am! What's that about armoires?"

Djanna looks at you in confusion. "What? What are th- no, Nadia. Armor. Ar-mor. Like, something you wear to keep you from getting hurt. Chain and leather, worn like a second skin."

"That sounds uncomfortable..." Your tail swishes as you imagine all the little links and seams pulling on your fur.

"Maybe, but this time it's just a cut. Last time it was just a cut. What if next time it's something worse?" She tries to sound nonchalant, but you can see the worry in her eyes.

A loud tearing sound interrupts your conversation, drawing your attention and Djanna's. You look over to see Nurrim carefully tearing the hide from the beast. The feathers, beak, and claws had already been removed and set aside, and as the hide peels back, exposing the musculature- yeah, definitely, that's a bruise. The hide is knotted in places. Scars. Punctures from the bee attacks.

You whine softly. Maybe Djanna has a point...

Soon, each of you loaded down with the beast's flesh, a few bones, and fangs, as well as sundry other pieces, you make your way back to the glade. There's a spring in your step, Djanna seems pensive, Emma seems on the brink of losing her breakfast.

>Talk to (Write-In)
>Other

>>40543431
Going with the flow has it. Writing.

>>40543431
Hey Nurrim could we make some armor out of the bear's hide?

>>40543431
You set about building up the fire once you return to the glade. layering logs and tinder for a low, slow burn under Nurrim's direction as she begins assembling what looks like a screen from green branches. She hangs this between two heavy branches overhead, and with Djanna's help begins layering it with meat from the kill. Emma lights the flame with her magic, trying her best to control her fire and finding it difficult. The impact of the flame spreads over the logs qickly, catching and starting the logs all at once.

Nurrim frowns and shakes her head. "No, no. Like I said, just chanting the spell isn't enough. You have to feel the flow of the mana through you, and not simply try to force it out. It may seem counter intuitive, but even if you're using flame, mana flows like a river. It can be a raging torrent or a gentle trickle, and the difference is you. If you learn to control how much mana you channel through yourself, your power will be that much greater."

Emma frowns and the older kitsune lays a hand on her head. Emma doesn't pull away. "I'll work with you on it later. For now, let's focus on making sure everything gets taken care of for the morning, hmm?" The younger girl nods.

Djanna has set about reorganizing the healing kit, after she finished treating your wounds, and begun repacking the bag for the second time since you'd left Dvotysk. She seems miles away, focusing on the task at hand.

Nurrim moves to a pair of trees, carrying the heavy bear's hide. She sets about stretching it between them, binding it with leather cords around the trunks.

It is at that moment that a familiar, but almost forgotten emotion settles into your stomach.

You're bored.

>>40543816
The adrenaline from the fight has worn off, the sting of the poultice in your wounds an uncomfortable reminder of the excitement now past.

You whine softly, looking between the three girls working in the clearing. Emma stands at Nurrim's side, chatting with her about controlling magic, Djanna is setting about her task...

>Talk to the sisters (Write-In)
>Talk to Djanna (Write-In)
>Set off on your own looking for something to do
>Other

>>40543841
>>Other
Curl up and sleep

>>40543841
>Set off on your own looking for something to do

ADVENTURE!

>>40543841
>Talk to Djanna

>>40543841
>Set off on your own looking for something to do

>>40543841
>Talk to Djanna

>>40543884
>>40543989
About?

>>40543841
>Set off on your own looking for something to do

>>40543841
Hunting for adventure has it. Writing.

Also, seems that the person who was supposed to be working for me tonight backed out, so now I have about three hours to get a nap in before my shift. Last update before naptime. I am a failure, and I apologize.

>>40544221
You sigh softly and rise, stretching out from your arms to your legs to your tail. You look between the three other girls and give a soft huff. Well, since they're all busy, perhaps there's something else that you can do. You turn toward the river, intent on a quick jog.

You take off into the woods, the sun-dappled path soft under your paws. You hear the calling of birds in the distance, the rushing of the river, and the howling of more unsavory creatures in the depths amidst the trees. It feels like it's been forever, a lifetime ago, since you've felt the pleasant burn of exertion for exertion's sake in your muscles. Your mind clears, the ache in your arms dulls, your breath comes in soft, sharp pants. You don't quite realize when, but your jog became a run, and the trees blur by you, a mass of green and brown.

You finally come to a stop you're unsure how far - or how long - later. The sun is still in the sky, you know that much. Beyond that, you're not aware. You look about, fairly certain you can follow the path back, but for now you're sort of glad to have a moment to yourself.

Kobolds, by their nature, are accustomed to living in close proximity, both in the sense of closely-knit family units, and the extended "warren" or "colony". For one to desire solitude is all but unheard of, and yet it seems such a way of living is stifling. Maybe that's why people tended to treat uncle Baltas as a curiosity... a misfit.

You consider it for a moment before your nose catches an odd scent, and you set off through the woods toward it. A minute passes, and you find yourself staring at an odd mass of lanky limbs, long tufted ears, a squat maw, and a long, slender tail. It looks up at you, black fur standing on end, and hises.

>CAT!
>CAAAAAT!
>CATCATCATCATCAT!
>Meh
>Other

>>40544330
Again, sorry guys. I'll be back as soon as I get some rest in. I was expecting to have the night open.

>>40544330
>>CAT!
>>CAAAAAT!
>>CATCATCATCATCAT!

>>40544330
>CAAAAAT!
>CATCATCATCATCAT!

>>40544330
>>CAT!
>>CAAAAAT!
>>CATCATCATCATCAT!
>>CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT!

>>40544330
>meh

>>40544330
>>CAT!
>>CAAAAAT!
>>CATCATCATCATCAT!

>>40544330
>Run Cat.exe

>>40544221
Lotus, are you Canadian?

On an unrelated note, I just read someones unfortunate story about how every kobold in the world was either killed or turned into werecreatures triggering a kobold diaspora and the slow but eventual death of the entire species. So I think its time for more cutebolds.

Catcatcatcatcatxat

I'm really enjoying the intense dog-like habits in Nadia. I feel like it's her past life rationalizing what she is now. I fear for the day when Djanna starts to take advantage of her with a squeaky toy

Awoooooo

>>40547104
Aw aw awooooooo!

>>40547104
>>40547670
Awooooooooo~

Up. Heading to work. Sorry, guys, I know I'm a shit. I'll post ASAP.

>>40548178
Awooooooooo!

>>40548178
>sad awoo

>>40548297
Awoooo

>>40548297
no sad. I have laptop.. Increase in quality.

>>40548342
>deadpan awoo

>>40548178
Hey!
Don't you fucking dare call my waifu a shit!

>>40548342
>Awoo- CAT CAT CAT CAT CAT

>>40544330
>CAT!
>CAAAAAT!
>CATCATCATCATCAT!
If my Rougelike game experiences are right, that thing could be a displacee beast. But this one doesn't have tentacles with toothed mouths. So...
Disregard that, it's CAT time.

>>40548490
My god. nadia with a pet baby displacer beast.

>>40548490
I'm almost certain it's a panther
Or, like, a werepanther

>>40548541
Just looked up displacer beast, and they look shockingly like panthers, so... Yeah.

>>40548490
>tentacles with toothed mouths
I mean it might have one. "Long slender tail" after all.
Maybe we just can't see the mouth from here.

Think of it this way, if it IS a displacer beast, we might be able to get a pet blink dog. And that would just be all KINDS of awesome

File: image.jpg (96 KB, 900x609)

96 KB JPG

>>40548631

>>40548535
>>40548541
>>40548591
In ADOM (the rouglike I played) the displacer beast had like a DV of like, 20~21? About that point of the game you have like 1d6+1~6 of hit chance(depending on weapon proficiency). They were either REALLY dodgy or were excelent at parrying with their tentacles. Either way, they were very hard to hit unless you used MAGIC!

Rolled 6 (1d10)

Gimme diiiice.
d100. For reasons.

Rolled 64 (1d100)

>>40548791

Rolled 87 (1d100)

>>40548791

Rolled 85 (1d100)

>>40548791

File: Embrace the DICE.png (165 KB, 720x643)

165 KB PNG

Rolled 23 (1d100)

>>40548791
Here we go!

>>40544330
Your tail quivers, your ears perk, and you give a low whine. The creature regards you in a moment seemingly frozen in time. You move as one, you rushing to give chase and the feline creature turns to flee, players in a ballet as old as time itself.

Or, just a ridiculously energetic kobold girl chasing a hapless catlike creature scared out of its wits. One or the other.

The two of you tear through the forest, heedless of direction or speed. To your credit, you keep pace, and to the cats credit, it keeps just ahead of you, dodging and weaving through roots, brush, and other obstacles like water flowing along a riverbed. The beast tears across a bare patch of the forest floor, kicking up leaves, and you stop short, skidding in the loam. It stops, casts a single backward look at you, and bounds away out of sight without another moment of hesitation.

You look down at what the cat's passage turned up: A net, buried under a thin layer of forest debris, each knot host to a long, wicked metal spine coated with a greenish oil. You reach out a finger and run it along one of the spines, avoiding the tip. Still liquid, still fresh. Your finger tingles lightly where you touched the oil, and whining, you rub it off on a piece of bark. You slowly walk to the edges of the path, carefully brushing away more of the detritus, revealing more of the net. It covers the whole of the pathway. A careful examination reveals a wire stretched taut roughly two feet off of the ground.

This... this definitely isn't something that's supposed to be here.

>Investigate further
>Go home. Something doesn't feel right.
>Other

>>40548966
>>Investigate further
We brave bold!

>>40548966
>>Investigate further
We can steal the net

>>40548966
>Investigate further

>>40548966
>Go home. Something doesn't feel right.

>>40548966
>Investigate further
>slowly, watching where we place our feet, and watching the bushes around and behind us

>>40548966
>Go home. Something doesn't feel right.
Best to inform Big Kitsune

>>40548966
>>Go home. Something doesn't feel right.
our friends are probably worried already

>>40548966
>Go home. Something doesn't feel right

>>40548966
>Go home. Something doesn't feel right.

>>40548966
>Go home. Something doesn't feel right.

>>40548966
>Investigate further
But be on guard. As soon as something pops,
>run back

>>40548966
>Investigate further

>>40548966
By my count, going home wins by one.

Let's see if you remember how, though. Gimme a d100-10

Rolled 80 (1d100)

>>40549120
Zorro guide us

Rolled 51 - 10 (1d100 - 10)

>>40549120

Rolled 37 - 10 (1d100 - 10)

>>40549120

Rolled 10 - 10 (1d100 - 10)

>>40549120

>>40549152
0!

>>40549131
Glad yours doesn't count!

>>40549152
You got dis.

Writing.

>>40549152
Awww, I was hoping for more adventure.

>>40549233
Well some of us didn't want more dangerous adventure by ourselves with no support at all

>>40548448
>>40548389
>>40548324
>>40548297
>>40548211
>>40547732
>>40547670
>>40547670
>>40547670
>>40547104
>>40547104
https://www.youtube.com/watch?v=iDpYBT0XyvA

>>40549257
Why did you link my one post 3 times?

>>40549322
Because my mouse loves to think one click is either 2 or 3 clicks

>>40549344
You have a strange mouse.

>>40549257
Id like to meet her tailor

Lotus die?

>>40548966
You're tempted to set off into the woods again, to see if you can track down who set the net, to find out why, and what they were after, but something about this feels wrong, and dangerous to you... and you've learned to trust your gut. You whine softly, taking a step away from the net and turning for home. A quick sniff of the air, and you follow your own scent back to the river. From there, it's a simple matter to return to the glade.

As you approach, you hear your friends calling out your name. Your ears fall slightly, a twinge of guilt taking hold of you. It's not like you were trying to cause problems...

Nurrim is the first to find you, frowning and scolding you as she marches you back to the glade. "Where did you run off to? You had Emma and Djanna worried sick!"

"Everyone was busy so I just went for a run! I wasn't tryin' to worry anyone, honest..." you whimper, tail tight against your legs. Nurrim gives a sharp yip and a few moments later, Emma and Djanna reappear.

"Where did you go!?" The younger kitsune barrels into you, gripping you tightly as Djanna just frowns at you.

"I just... I mean... th-that's not important now! Listen, I don't think we're alone here..."

You tell them about the net and the strange green oil. Nurrim nods along, looking unperturbed. "It just sound like hunters. Probably trying to cache meat before the cold season hits. I'm glad you weren't hurt."

You shake your head. The answer makes sense, but...

"But if they were just hunting, why the green stuff? Wouldn't that make the meat bad?"

"I'm not sure, but I don't think it's anything we need to worry about." The elder kitsune rests a hand on your shoulder gently, giving it a gentle squeeze. "But if you're worried, for now, I think we should stay close to the glade. We have meat enough for a while yet, and plenty of work to be about with Emma's training. Would that make you feel better, pup?"

>>40549701
You nod. At this rate, it's likely the best you're going to get. Still, something doesn't sit right with you. Your fingers still feel numb from where you touched the oil, and given the height the trap was set at, what could they have possibly been hunting? The large bear monster was the only thing you'd seen that was tall enough to trip it... besides the four of you in the glade. You shiver at the thought.

>Leave well enough alone.
>Try and convince Nurrim to go have a look with you.
>Other

>>40549628
Contrary to common god-damned sense, when the weather gets bad (as it is presently), we get busy as fuck for reasons I don't understand. "Hey, it's storming like crazy! Let's go buy slushies!"

>>40549722
>>Try and convince Nurrim to go have a look with you.

I believe in the doctrine of twitch

Orcs are behind everything

You are only safe when you are encased in enough traps and explosives to destroy a small army

Its a trap!

If it does not appear to be a trap it is merely part of a very complex trap!

>>40549722
>>Try and convince Nurrim to go have a look with you.

>>40549722
>Try and convince Nurrim to go have a look with you.

Not hunters Poachers. Bad peoples.

>>40549722
>Try and convince Nurrim to go have a look with you.
Finally caught up just in time!

For what it's worth, I never saw a bait and switch in the early threads. It just looked like normal plot development in a fantasy story, and it's nowhere near being edgy. You're doing a good job, man.

>>40549722
>>Try and convince Nurrim to go have a look with you.

>>40549722
>Try and convince Nurrim to go have a look with you.
This is clearly suspicious on my scale of things.
paralyzers with nets big enough to catch humanoids?

>>40549722
Investigation it is. Writing. Again, sorry, but kind of busy tonight. Updates will come as demands of business allow.

>>40549781
I appreciate the vote of confidence.

>>40549722
You shake your head. "But... but the tripwire. I mean, if they were hunting big game, maybe, but the... the big bear was the only thing I've seen so far that could trip it... except us..."

Djanna suddenly looks quite interested. Emma looks to her sister, worry in her eyes. Nurrim chews her lower lip in thought. "There are other things in the forest that could have tripped the trap, I'm sure... and when did you become knowledgeable about hunting, anyway?"

You whine softly and shake your head. "That... that isn't the point. Please, just... come have a look with me? It'll be quick, I promise."

Nurrim shakes her head, ready to outright deny you, but Emma lays a hand on hers. "It might not be a bad idea. If nothing else, it means there are other people in the forest."

The elder kitsune considers the point for a long moment before shrugging. "If it will help put you at ease, I don't see why not. Do you remember how to get to the net?"

You nod quickly, turning and all but dancing to the path out of the glade, turning and looking to the elder woman expectantly. She turns to Djanna and Emma, as if ready to direct them.

>Suggest they come along.
>Suggest they stay behind.
>Other

>>40550047
>Suggest they come along.

>>40550047
>Suggest they come along.

>>40550047
>Suggest they come along.

>>40550047
>Suggest they come along.

>>40550047
>Suggest they come along.

Rolled 5 (1d10)

>>40550047
Family outing it is. Writing.

>>40550047
You pre-empt Nurrim, stepping forward. "Let's all go together. I don't want anyone to get left behind here in case something happens."

Djanna nods, but Emma frowns softly, her ears folding back. "What... do you think might happen?"

You can't answer her. Something in your gut is telling you that you don't like the situation one bit. Maybe it is just a hunter, maybe it is just somebody trying to stockpile meat for the winter, but even so... the razor net, the incessant gnawing apprehension in your gut.. something is off and you don't like it. Emma, as if sensing your unease, simply nods and moves to your side, slipping her hand into yours.

Nurrim frowns, but doesn't object. She looks to the skin she has drying between the trees, and the smoking meat above the fire. "Well... hopefully if somebody finds it they'll just think it's another hunter's camp." She crosses her arms over her chest and shakes her head, but says nothing more about it. Soon, you're leading the three of them back toward where you found the net, and in no time at all you, Djanna, and Emma are standing aside as Nurrim examines it.

"Well... this is certainly a bit meaner looking than I assumed. Definitely meant to cause suffering as well as disable and snare..." Nurrim scowls, circling the net outside its perimeter. Grabbing up a stick, she reaches out and with a quick flick of her wrist, trips the wire. With a snap, the net flies up between two trees on a tension rope, drawing close. The needles flash in the sunlight, and you wince involuntarily.

"Whoever set this will come back to check it eventually. Maybe we should wait? Set up an ambush for them?" Djanna suggests as she moves to stand beside you.

>Set up an ambush
>You don't want to meet somebody who would set a trap like this...
>Maybe we should find them first.
>Other

>>40550572
>Set up an ambush

>>40550572
>Set up an ambush

Rolled 42, 76, 56 = 174 (3d100)

>>40550572
Ambush it is.

Rolling for Emma, Djanna, Nurrim.

Gimme some dice for Nadia.

Rolled 88 (1d100)

>>40550800

>>40550800
Goddamnit Djanna.

Rolled 62 (1d100)

>>40550800

Rolled 54 (1d100)

>>40550800
Dat djanna luck again though.

Rolled 88 (1d100)

>>40550800

>>40550800
Surprise, surprise. The illusionist is the only one who passed.

Writing. Slow, but writing.

>>40550982
Always hiding letting her friends get hurt first

Rolled 1, 12, 73, 29, 84, 35, 1, 92 = 327 (8d100)

>>40550982
Defensive dice please.

Rolling for Djanna and Nurrim, and the unknown assailants.

Rolled 20, 53 = 73 (2d100)

>>40551062
And the assailants on you.

Rolled 52, 82 = 134 (2d100)

>>40551062
PANIC

>>40551062
Djanna passes her defense check with two DOS.

Nurrim fails hers by two DOS.

>>40551082
Single d100, best of three for Nadia. Malformed dice aren't counted.

Rolled 69 (1d100)

>>40551062

Rolled 57 (1d100)

>>40551095

Rolled 85 (1d100)

>>40551095

>>40551141
You fail your defensive check by three DOS.

Writing.

>>40551150
Thought it was best of three, We still have one roll left

>>40551150
So close...

>>40551181
>close
I'm sorry?
We missed by 37

>>40550572
You lie in wait, fanning out into the underbrush, waiting along the path for whoever set the trap. It's a long wait, far too quiet. Day passes to evening, then to night. Finally, Djanna rises from her position and stretches.

"I don't think whoever set the trap is coming back. Let's head-"

From out of the shadows, a dagger flies toward Djanna. The dragon girl jerks to the side, the blade grazing her scales before embedding itself in a tree. Nurrim rises with a cry of surprise, stepping out to run to her. From above, a whispered word calls down a bolt of lightning from a clear sky, striking the elder woman. She shrieks in pain and falls to the forest floor, spasming violently before she falls still, eyes wide and panting. You roar as you lunge out, desperately casting eyes and nose about left and right. How!? How did they escape your notice!?

You see the cat lope into view on the path ahead. It sits calmly, regarding you with it's bright yellow eyes. Slowly, it begins to shift in form, growing taller, lankier. It's skin falls open around it, revealing a humanoid form clad in patchwork leather, looking cobbled together from dozens upon dozens of different hides. A leather mask conceals everything but blazing, hateful yellow eyes, the skin cloak giving off the scent of autumn leaves and dozens of different beasts. The figure continues to swell, its form shifting into that of a large, scaled monstrosity with a long, reptilian snout. It opens its maw deeply, a foul odor filling the air about you. With a deep belching sound, it spews a cloud of gas at you. You throw your arm up in front of your face, but it's too late.

Your vision swims, your head pounds. You black out.

============================

>>40551310
You wake up lying on cold, damp earth, the sun a dim suggestion above. Heavy wooden beams lay across the top of a square opening some ten feet above you, barring the top of the pit you find yourself in. You hear laughter, the sound of a blade being sharpened, and smell the coppery stink of blood in the air.

"Who'd have thought there'd be so many in one place? Shame there's just the one fox-woman. They're worth a pretty penny down south."

"At least the dragon will be a quick sell. Lot of good parts on 'em. Alchemist's love that shit."

"What about the dog?"

"Think it's some kind of werewolf, maybe. Hell if I know. Worse comes to worse, Malachi gets a new skin. Ain't that right, freak?"

"Eh, leave 'im alone. You know he don't talk."

Your heart pounds in your chest. You rise unsteadily to your feet, a whine in your throat.

>Call out for your friends
>Demand answers of the voices above
>Try to break out of the pit
>Other

Waaaaaaaaaat

>>40551327
>Try to break out of the pit

>>40551327
>Demand answers of the voices above

At least Emma made it out. Best not to call to her yet though, since they don't know she's around.

>>40551327
>Other
Sniff around the pit, find weaknesses.

>>40551327
>Try to break out of the pit

>>40551327

> Shoryukin!

Also, yeah, pretty sold on the whole "DCs are better than counter dice". This grim derp shit is kind of harshing my mellow.

>>40551327
>Try to break out of the pit

>>40551327

> You are doge
> You are miner doge
> Dig counter shaft out of the pit

>>40551327
>>Try to break out of the pit

Can we ask for help from the big man upstairs?

>>40551378
>This grim derp shit is kind of harshing my mellow.
Same, Next thing we know Lotus is going to have us see a skinned Emma or Djanna

>>40551390
>Minor Miner Doge

>>40551496
>Dodge, minor miner doge!

>>40551427
Gotta be honest. Not feeling the love, guys.

Escape attempt it is, and I'm getting some digging in the future.

Dice!

Rolled 61 (1d00100)

>>40551526

>>40551526

Rolled 23 (1d100)

>>40551526

Rolled 15 (1d100)

>>40551526

File: Polt used DIG!.jpg (74 KB, 431x387)

74 KB JPG

>>40551526
Did someone say DIG?

Rolled 25 (1d100)

>>40551526

>>40551569
You're a bold and you're digging a hole.

Also, let's get this out of the way now: characters can die. It's not being "grim derp" to introduce consequences, or depict brutality in what amounts to a savage world full of monstrous creatures. You're entitled to your opinions, but that's just how it's going to be. As Nadia gets older, stakes will raise. I've said this before.

If you can't stomach that, I'm sorry. Thank you for following along as long as you have.

Rolled 23 (1d100)

Rolled 54 (1d100)

Newcomer here in case of TPK

>>40551427
A) that's a total overreaction.
B)how would we even know? All there skin would be gone.
Unless you mean we find their skin. But, even so, it'd be in recognizable without the skeletal structure.
You make no sense, sir.

>>40551721
God.
Fuck you autocorrect.
*Their
*Unrecognizable

>>40551610
Well that's kind of out of left field, Since y'know this was supposed to be cutebold adventures, That IS what you advertised it as afterall, Also i Highly recommend giving major npcs plot armor, Atleast some, Otherwise eventually all our close friends and family will die and It won't be cutebold adventures anymore, It'll only be depressed grimdark bold survival

>>40551327
You don't like what you're hearing one bit. These sound like dangerous people... the kind of people you were warned about by Nurrim. You whine and pace the bottom of the pit, looking for a way to escape. There's nothing to climb, nowhere to get hand or foot holds, and the bars are too high above for you to jump and reach. In frustration, you punch the wall, and find the soil hard, but yielding.

The gears in your head slowly begin to turn, and you bear your claws, sinking them into the soft earth. With powerful strokes, you begin tearing at the wall of the pit, the soil yielding under your assault. Soon, you've begun to tunnel through toward... you're not sure, exactly, but it's not the cage they put you in. The voices grow quieter, and all too soon, luck seems to be on your side as you break through into another pit. Nurrim lies on the bottom, her hands bound behind her back, her mouth gagged and an angry look in her eyes. She looks up at you in shock as you burst through the wall of her pit, covered in dirt, your tail wagging anxiously.

She speaks, but it's muffled by the gag. You give a soft whine and bound over to her, crouching and digging at her binds until, finally, the rope snaps. She reaches up and removes the gag, hissing a whisper.

"How did you know where to find me?"

You shrug, shaking your head softly. She shakes her head likewise. "Nevermind that now, it doesn't matter. Are you okay? Do you know where Emma and Djanna are?"

"I don't know..." you whimper, tail sinking. "I just saw somebody in a really torn-up looking cape coming after me, then I... I fell asleep. I don't remember what happened till I woke up back there." You jerk your head back toward your own pit, and Nurrim nods.

"All right... we need to work quickly. These people, they're dangerous. They... you don't want to know what they have-"

>>40551765
Maybe at the beginning it's what was expected, but by this point in the story it should be more apparent what he's going for.

>>40551765
Not everything can stay cute and innocent forever, and Nadia hasn't grown up yet.

>>40551772
A mist begins to slowly drift in from the top of the pit you're in, the sun dampened out by clouds rolling in overhead. A ghostly moaning fills the air, and you hear a few of the voices above start whispering back and forth in hushed, worried tones.

"The hell's going on?"

"Don't suppose we pissed off something in the woods..."

"Don't get all superstitious on me now..."

"Malachi, go check it out."

You hear the sound of footsteps moving away from your location, and seemingly between footfalls the light, human sound is replaced by the loping thud of wolf paws.

>Have Nurrim boost you up
>Boost Nurrim
>Coordinate (Write-In)
>Other

>>40551790
>Have Nurrim boost you up

>>40551790
Maybe you shouldn't advertise it as cutebold quest then, Also clearly state upfront in the beginning of a thread that it's going to be a grimdark quest where Nadia will eventually lose her friends and family, Because as you know dice will eventually give us bad rolls and we'll lose people, And it will continue to keep happening til Nadia is left all alone by herself

>>40551790
>Have Nurrim boost you up
>Pull her up when you have secured the top

>>40551808
That, or you could maybe realize there can exist a happy medium between the two.

Hugboxes lack progression, and full-bore crapsack settings lack engagement because no matter what you do, nothing matters. You don't think I can balance? I find it funny the argument has only come up the first time you legitimately failed a role in this quest.

>>40551790
Nurrim boost wins it. Writing. Have to get busy, so last update for the night. Keep it bumped and I'll pick it up tomorrow afternoon.

>>40551790
>Have Nurrim boost you up
We can try to scent in which direction Djanna's smell is, and then dig in that direction.

>>40551790
Fuck this disconnection, I got left behind!
>Have nurrim boose you up
looks like the guys are gone. Also, the mists? Wonder who...
also this was unexpected, I never thought manhunters (or is it monhunters?) were a thing in this setting. At least we know now.

>>40551978
>I never thought manhunters (or is it monhunters?) were a thing in this setting. At least we know now.
Did you somehow miss Emma's entire backstory?

>>40551978
They were alluded to when the story of the Czar came up, when there were pogroms against the monsters after he went nuts.

These are a carry-over from those times, unsavory types who cater to a very specific, very depraved clientele.

>>40551790
You look to Nurrim, then to the cage up top. Between the two of you, maybe...

"Hey... can you give me a lift?"

Nurrim nods and crouches down, holding her hands together. You plant your heel in her palms and she stands, struggling to heft you. You may still be small, but your muscles easily make you heavier than most other 'bolds your size. You can almost reach the top of the pit, and with a quick hop, you grab hold of the bars and pull yourself up.

You see a trio of humans, one armed with a bow, another with a hatchet, and another with a short, broad-tipped spear, standing back-to-back, looking about the large clearing they've set up camp in. Racks of drying meat and hides occupy the center of the camp, and near as you can tell, they look unfamiliar. You give a soft sigh of relief.

The scene is familiar; The day has grown dim, clouds covering the sun. Mist covers the ground, foxfire dancing in the woods, a ghostly wail and rattling like bones filling the air. You hear soft, bare footfalls approaching you, and the tell-tale swish of a pare of long, plush tails. You wag softly, the motion threatening to loosen your grip.

"Emma!" You hiss out a whisper, smiling. You hear a soft "Shhh" from in front of you. A small piece of sharp rock seems to appear from nowhere, and the kitsune begins sawing at the leather thong binding the cage to a stake driven deep into the ground. Soon, the binding is broken, the cage loose. You drop down and Emma drags it just far enough away from the pit for you to wriggle out, after Nurrim gives you another quick boost. You reach back down and drag the elder kitsune out of the hole.

"Where's Djanna?" Emma asks. You turn your nose to the air and sniff deeply. The reek of blood fills the campsite, and under it you smell the telltale stink of ozone and heat, coming from a large cage on the opposite side of the clearing, near the hunters.

>Attack!
>Stealth!
>Other

>>40552016
>Attack!

>>40552016
>Stealth!

>>40551765
I bet you forfeit the mission when your characters die in Fire Emblem.

>>40552016
>Stealth!

>>40552016
>Stealth!

>>40552016
>Stealth!
>Attack!
Sneak attack critical for 2x damage!

>>40552016
>>Attack!
>>Stealth!

>>40552016
>Stealth!

Rolled 85, 39, 32 = 156 (3d100)

>>40552016
Stealth it is.

Dice vs. Mook perception.

Rolled 85 (1d100)

>>40552181
I'm assuming you want us to roll?

Rolled 96 (1d100)

>>40552181
This isn't going to be good.

>>40552207
Yes.

Rolled 92 (1d100)

>>40552181

Rolled 20 (1d000000100)

>>40552181

Rolled 74 (1d100)

>>40552001
>>40552002
Welp. Sorry. I couldn't connect the dots.
but cut me some slack, it's hard to stay up a night, and following a quest with that too.
>>40552181

>>40552233
what the hell is that die mate

>>40552233
Thank you for saving us
The dice gods are harsh on us today

>>40552207
>>40552228
>>40552232
Bad news: You get spotted.

Good news: Just means youbdon't get a surprise round.

That's all for tonight. Keep it bumped and I'll finish up after work or tomorrow.

I'll be here for Q&A if you like. Otherwise, thanks for coming and get some rest.

>>40552237
Hey, no worries. I wasn't giving you shit, just elaborating.

>>40552246
Wait, I just noticed that too.
are we fucked?
Isn't that technically a d100?

>>40552269
God night lotus
i'll pray for djannas safety since she rolled the worst on the encounter.
we're gonna go no mercy on these fools.
I wonder if the claws will work since the guys are being mean to us?
I don't even know what I'm typing now.
good night lotus

>>40552233
Dude.
Fucking stop.
It doesn't count when you do that, and you do it literally every fucking time.

>>40552286
You shouldn't have an issue with the mooks since they're... Ya know. Mooks.

If Malachi comes back, flight is advised.

G'night.

>>40552269
Well, attacking seems to work for the most part anyways.

>>40552320
I wonder if we get a BerserkBold upgrade since we haven't defended a single time yet in the quest.

>>40552361
Wait.
There's a defend option?
I always though the he wrote down "attack" twice.

>>40552361
Funny you should mention that, since nobody's bothered to ask about those little additional rolls I've asked you to make from time to time.

DOTH THOU DESIRE THE POWER?

>>40552384
We got the option to defend in a dream, but when it gave us the option for a defensive evolution, we didn't take it.

>>40552388
Wait what

>>40552458
First thread and once or twice after I've asked you to make rolls for a "surprise." Never hit what I wanted you to hit, so it never fired.

>>40552388
Yes. Yes we do.

>>40552489

My fist is the divine breath! Blossom, o fallen seed, and draw upon thy hidden powers!! Grant unto thee the power of the glorious ‘Lord of Annihilation’!

Naw. But I mean, can you imagine?

>>40552361
Thou art I, and I am thou. From the sea of thy soul I cometh, I am BerserkBold, master of fists.

Rolled 70 (1d100)

>>40552516
So, what you're telling me is that we need to get a REALLY BIG sword for when we get HUGE and have HUGE GUTS?

Because we're working pretty hard on that in a fairly consistent manner.

>>40552516
Okay. Nadia is really concerned with family. She's also really peppy and supportive. As much as people see cleric and scream "Healbot," clerics also can form the moral and, at times with the right personality, emotional core of a party. I know you're all up in the idea of Nadia as a monk, but to me that implies a certain degree of detachment.

So, if we're talking classes and evolutions, what do my players see as hee most logical progression?

>>40552613
Personally, I project paladin.
Just with particular focus on the protection of family and friends.

And no sword. Her claws are holy weapons and her paws are holy symbols, after all.

>>40552647
If I may ask, where do you draw the line between Cleric and Paladin? Is it a matter of caster focus vs. martial?

>>40552613
I don't see her fitting into any D&D class, but I would like to see her as someone who doesn't follow a god out of faith, but has the gods assist her because they approve of what she's doing.

We're here to do the right thing. Seriously, we're so Good it hurts.

Personally I would like to see her deal more damage the more she's wounded, or the more her friends are injured or at risk. As well, obviously we're going for an anti-evil magic, so something like Smite (which we already have) and purification.

Totally not a Phys Adept Magical Kobold Girl Oh god yes please Phys Adept Magical Kobold Girl.

>>40552613
Definitely holy. Some paladin or cleric or monk.

>>40552717
I agree with this guy, but I secretly want paladin.

>>40552674
I want to be friends with the gods, not servants of them. Besides, our ultimate power lies in doing what we know is right and protecting our friends with pretty much zero concern for our own safety.

But not as some sort of holy mission, instead just because it's who we are.

Just because the world is crap, it doesn't mean we can't still be a cutebold.

I would personally like to stay away from defining ourselves with D&D classes though.

>>40552717
I really, REALLY want to tip my hand here... But no.

As for doing more damage the more injured she is, that's a Berserker trait.

>>40552736
Well, job classes in RE world are a thing. That's the context in which I was asking. Tagging them with D&D classes just makes for easy shorthand.

>>40552738
Well, like I said we haven't chosen to defend a single time yet.

IDK, people keep saying Paladin because we're stronk & blessed, but we don't really worship or have faith in the god, he just kind of helped us out. Besides, it seems like we'll have to deal with too many fanatics like our Mum if we do that.

I'd rather be a Berserker who happens to have the favour of the Gods, like a Champion or some shit rather than a Holy Roller.

Phys Adept Magical Kobold is the best choice and you know it, though. Instead of spells, we get faster and stronger and start to get Light/Fire/Holy damage bonuses.

>>40552777
You just want a frilly costume and transformation sequence. Admit it.

>>40552777
Most people forget that berserkers WERE blessed by the gods - their berserk rages were them being possessed by the gods or the spirits of their ancestors.

>>40552789
Yes, but also to get HUGE.

Job systems are only for Humans though, monsters get the Rank Up which is more organic based on your actions. Kind of like leveling in Elder Scrolls.

> An example of Rank Up would be E, who as a Hobgoblin, demonstrated proficient skill in mining and Ranked Up into a Half Earth Lord. Occasionally, the Monsters receive [Blessings], [Divine Protection] or other mutations, making them either [Variants], [Subspecies] or [Rare Species] of their kind.

>>40552809
wait. So monsters don't get job classes?

>>40552753
How closely do you want to stay to the source material?

> Kobold lifestyle is fundamentally that of a warrior or Samurai.

>They eat their own kind many times. The strong inevitably feed on the weak. Fuelled by the ambition of one day becoming “Lord,” they kill and eat each other.

I say we get basic upgrades for being consistent (Attacking, Defending, Working Out to get Huge, etc.) and blessings and mutations for either big/difficult choices or doing something awesome, like when we killed the shit out of that ooze or healed our dad.

And we'll just kind of make up the fluff so we can be a Berserk Bold who is blessed by the sun.

File: 1433137115619.gif (57 KB, 208x200)

57 KB GIF

>ALL THIS evolution talk that I don't know anything about
SEND HELP

>>40552852
Correct.
That's why they get Evos.

>>40552852
Nope, just evolutions.

>>40552870
Pretend we're playing D&D, but the PCs are all Pokemon and don't have classes.

So...pretend we're playing Pokemon.

>>40552865
Not at all. By most accounts, source a shit.

>>40552874
>>40552876
Well... Fuck.

>>40552876
>>40552874
Of course, it is your interpretation of the world, and if you wanted to allow a monster to take a job, nothing's technically stopping you.

>>40552870
Basically, the more shit you do the better you get at it, and if you do enough of something you can evolve into a specialized version.

So that's why we're getting huge, so we can be a muscle bold.

Blessings are given out by Deities for great deeds done, or just because they think you're a pretty cool guy, fucks up the baddies and doesn't afraid of anything.

Mutations can come from failed magic, multiple blessings from the Gods, or as a reaction to defeating extremely strong specific enemies. IE, if we fought poisoned enemies we might develop an immunity to poison, or the ability to purify our blood. When we evolve, that would increase to maybe we can now poison ourselves, or dope ourselves with adrenaline instead, or purify things depending on what kind of things we had been doing.

IE, alchemists would learn how to poison others, fighters would have hyper-adrenal glands, and magic users would be able to purify.

>>40552901
I personally like the idea of just working towards things we want to level up so that we don't have endless fights about what our "class" is like we did with weapons a few threads ago.

Just ask people what they want Nadia to be able to do. So far, we know she wants to be HUGE, and she seems to be all about H2H fighting, and she's utilized her blessing more to help others than to hurt.

I'm telling you guys, Physical Adept Magical Kobold, it even fits with the people who want this to remain a Kutebold quest in some ways.

We'll see someone in trouble and hulk out, then playfully bat at their tails or ask embarrassing questions incessantly!

>>40552924
I was just using it like >>40552809 mentioned, where classes just determine how fast what levels up.

>>40552901
Hey, man, I recommend just thinking about what would be fun for you to write.

Do you want us to keep doing rolls for "surprises"? Or to have us get small increases per thread and then add them up every so often and make them into an evolution that changes our appearance?

Do you want us to have a rigidly defined role and skill progression (if so, I recommend getting Anons to pick roles they would like to see and then defining them yourself, otherwise we'll just fight for many threads).

You're the one writing this. I personally like the Berserker idea, mostly because it fits what we've been doing, but ultimately you're the one writing this.

But just because I think seeing our character evolve organically based on our decisions in-game, doesn't mean other people feel the same.

>>40552977
Can we pick Berserker class then?

File: Berserk Bold.jpg (174 KB, 900x675)

174 KB JPG

Rolled 83 (1d100)

>>40552977
So, this is what we're aiming for?

File: fullmoon_by_pokkuti-d4e8hdc.jpg (133 KB, 744x1052)

133 KB JPG

>>40553109
Nah, too human. More Kobold is needed.

>>40553109
With less tit? Yes.

File: She's even a Nun!.jpg (136 KB, 800x935)

136 KB JPG

>>40553109
>>40553135
>>40553137

Guys. Guys. H2H fighter. Is also a holy Warrior subclass sexy nun.

Only problem is she's a kitty instead of a puppy.

File: Rila.jpg (326 KB, 827x1169)

326 KB JPG

>>40553149
What about Rila from SNK?

https://youtu.be/iad3wvLO7rU?t=12s

We've got <40 Replies left before saging. I say just junk this thread and let QM start a new one.

>>40553149
Dog-nun will cure you of your sins! Through castration!

>>40553149
CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATAMARANCATCATCATCATCATCATCATCATCATCATCATCATAPULTCATCATCATCATCATATONICCATCATCATCATCATCATASTROPHECATCATCATCATCATCATCATCATCATCATCATCATSCANCATCATCATCATCATCATCATCATCATARACTCATCATCAT

>>40553191
>CATAMARAN
>CATAPULT
>CATATONIC
>CATASTROPHE
>CATSCAN
>CATARACT
>hue hue hue

>>40553184
I-it's okay... if I can't use them to give her healthy puppies, I don't really need them at all.

>>40553203
>hue hue hue
You summoned me?!

You hang upside-down, hands tied to the fround and legs tied to the skies, as one of the humans grabs you by the head and spits into your face, "What the fuck are you good for you piece of mangy fur? Huh? You kill my men, you kill my family, and for what? To live another day? Pa-fuckin'-thetic."
You struggle as much as you can but all you can do is bring pain unto already strained and bruised muscles.
"And now, this is what you monsters," The man forces out, as if he was trying to rid his mouth of shit,"deserve." And you see what he's standing next to. WHO he's standing next to. Emma.
You wriggle and squirm as much as you can but get a punch to the stomach for your trouble.
"Make her watch." Your head is held in place as the man starts cutting into Emma's skin, starting with her scalp, then her skin, then her tails. Halfway through Emma wakes up, a screaming, trashing mass of meat and blood.
The man doesn't care and continues cutting until her skin is free of her body. He doesn't even give Emma the mercy of death, letting her scream her lungs out.
After this you just stop functioning. You ignore the skinning of Nurrim, of Djanna, and when the man sits down to look you in the eye and say something you are dead to. You ignore the rasp of knife against throat and let yourself fall into a deep sleep.

>You have died.
>Do you hold onto the memories of the past? Y/N?
>>Y
>Warning. This will erase your past memories. Are you sure you want to keep this life's memories? Y/N?
>>Y
>You gain a blessing: Chosen of KRA.
>Your anger moves your body in place of your soul. The greater your anger the greater your strength. If you ever lose your anger your body will collapse as it now has nothing to animate it. You may reflexively call upon a memory to rekindle or increase your anger.
>Reincarnating in...
>3
>2
>1
>Reincarnation: Human, Dvotsyk

>>40553191
>>40553203
Catsplosion.

>>40553505
Honestly, your writing has improved quite a bit.
Even if it reminds me of that MLP creepy pasta at some points.

>>40553549
Whilst it's nice to hear that I would prefer if you pointed out where it has improved and how it can improve further/the areas in which it isn't developed as much.

>>40553563
Huehuehue, I thought you preferred smut, not grimderp.
Unless that's your magical relam, then you have a terrible taste.

>>40553577
Burned out on smut recently, trying to magical realm death just to clear that out. Maybe smut later. Male-Kobold vs. Female-Dragon, Femdom.

Also;
>>40553505
You have gained 2x Hue
Your total Hue: 5

>>40553563
It feels a lot less cobbled together.
I don't know how to describe it, but it's along the lines of falling into your own writing style, instead of mimicking someone else's.

As far as improving? A few grammar issues, a couple mixed words.
Also, I want to be able to feel it. Well, ok this is a bad example. I don't want to feel my friends being murdered, but you know what I mean.

The five senses are very evocative in writing, and any way that you can involve as many of them as possible in your writing is going to get a better reaction.

For example:
>Your head is held in place
Is far less impactful than
>You feel a pair of cold clammy hands on either side of your head, forcing you to stare directly at your friend.

>>40553229
I... wut?

>>40553505
...the fuck is wrong witchu...

>>40553737
I was summoned and so must perform my duty.
To HUE! And Hue!! And HUE HUE HUE!!! Don't worry, I only get intense when shits slow/boring. The other will be... 'tamer'.

>>40553610
>>You feel a pair of cold clammy hands on either side of your head, forcing you to stare directly at your friend.

Why use 6 words when you can use 20? Remember, brevity is for people who don't want to impress their friends with just how very special and clever they are!

>>40553505
What the fuck, I post some muscly cat girls and this is what I come back to?

> https://www.youtube.com/watch?v=DUSojCb193U

This is all that soothes the pain.

>>40553809
It is always a balance between brevity, detail, and (in the case of quest-writing) speed.
The best writers will be able to maintain this balance, lesser writers will either stick to brevity or detail solely.
The only way to solve this is to build up your vocabulary and practise building sentences in various ways.

>>40553809
Given that he's writing single post stuff maybe once every other thread, he can afford the detail.

Also, he should be writing smut. And smut needs a lot of detail.

>>40553822
https://m.youtube.com/watch?v=SMWi7CLoZ2Q

>>40553859
https://m.youtube.com/watch?v=5_sfnQDr1-o

https://m.youtube.com/watch?v=X2F4EFYM_MA

https://m.youtube.com/watch?v=uhrdq1N9sgQ

https://m.youtube.com/watch?v=k8Jtm1eNpeU

Parry Gripp is great

>>40551310
>You see the cat lope into view on the path ahead. It sits calmly, regarding you with it's bright yellow eyes. Slowly, it begins to shift in form, growing taller, lankier. It's skin falls open around it, revealing a humanoid form clad in patchwork leather, looking cobbled together from dozens upon dozens of different hides. A leather mask conceals everything but blazing, hateful yellow eyes, the skin cloak giving off the scent of autumn leaves and dozens of different beasts. The figure continues to swell, its form shifting into that of a large, scaled monstrosity with a long, reptilian snout. It opens its maw deeply, a foul odor filling the air about you. With a deep belching sound, it spews a cloud of gas at you. You throw your arm up in front of your face, but it's too late.
Wait.
monster monhunters?

>>40554000
Malachi is... different.

>>40554024
Uh.
okay. Whatever, I guess we'll get to know what it is soon enough.

>>40554095
he's hard to define. biologically, he's an augmented human. mechanically, he's about a dozen monsters.

>>40554120
So... God Eater without the God Arcs?
Monster Hunter with the Equipment being the person's body?

>>40554142
I haven't played either of those.

A skinchanger who needs to periodically collect new skins.

>>40554156
Is that like a Class, Blessing, or Race for Malachi?

>>40554156
From a select few info of what I know about monster hunter series, your abilities and stats depend on what you're wearing, not leveling up the character themselves. Forging gear from fallen monsters to hjnt stronger monsters is how it works in that series.

>>40554181
If I had to put it into one of those three, I'd put it closer to a blessing than anything else.

>>40554183
So noted.

>>40554193
But it's not a Blessing per se, right?
So it's definitely something bestowed upon by or taken from a god or similarly divine being.
...
Is this mofo' the Chosen of Gra?

Meat cupcakes are not cookies.

>>40554218
I do believe (and correct me if I'm wrong) that there were other gods besides those eight.

Those just happen to be the eight primals. At least, according to the people associated with them.

>>40554229
The wording indicates to me that, yes, he is the chosen of a God. But not any that we currently know.

Is juice still a juice when it has been frozen into ice-cubes?

>>40554257
You can either believe that...

Or believe there are more people out there who can peel Emma like a banana and take her form at whim.

File: 1433186291777.png (52 KB, 188x162)

52 KB PNG

>>40554257
>Is juice still a juice when it has been frozen into ice-cubes?
My captcha just said tea is a juice, step your game up.
>>40554263
>peel Emma like a banana
>

>>40554263
>take her form at whim.

Wait, liker her species, or literally her form, face and all?

>>40554275
You can blame Hue^3 for that one.

Of course he neglected to mention the quivering, shrieking mass of what used to be your little sister reaching out toward your bound form with a trembling hand, salty tears searing her cheeks like acid as she mouthed your name, begging for help she knew you couldn't give, before losing all power to move and laying still on the ground, begging silently for death to hurry up.

SEE, FUCKERS?! THAT IS GRIMDERP! I CAN DO IT, AND I CHOOSE NOT TO!

>>40554293
The latter, but imperfectly. His eyes still show through, and people who knew the poor fuck he skinned when they were alive would notice something off about Malachi in his shifted form, even if they couldn't put their finger on it.

>>40554296
As the first reply of the post-saged thread I feel honour-bound to tell you I have travelled wide and far across this land called the internet and into it's darkened corners. And there I met sick fucks who will gladly masturbate all over what you have written.
Jesus fuck christ the shit I have seen cannot be be unseen.

So please, never go grimderp. Even if Hue continues to write grimderp instead the smut he promised.

>>40554341
No worries. Things may get serious. Things WILL get serious.

But things will not go gratuitously grisly, grim, or horrible. Operative word may be gratuitously, there, but still. All you have to do is not fuck up.

Easy, right?

>>40554341
As an aside, I'm more concerned about the anon earlier who said (if I didn't misunderstand) he was okay being castrated since he couldn't impregnate Nadia. That's... not right.

>>40554394
Either he was a) Joking on a autistic level, or b) That is his fetish.

>>40554412
Let us hope.

On that topic, though, assuming she doesn't die horribly, assuming it happens organically, do you guys think you want the family end for Nadia, or the Unending Adventure ending? A bit early to think about it, I know, but I'm curious.

>>40554424
I just want Nadia to be happy. Family

>>40554424
Let me just say that I don't think Nadia getting her memories of her past life back will have much of an impact since she's already so well-adapted to her new life.

As for the end? Unending Adventure if she can bring at least one "family" member like Emma or Djanna along, otherwise she's not going to see what's the point of adventuring if you don't have family to share it with.
The only reason Nadia has children is so that when they grow up she can go adventuring with them. Genkibold-Mom, GO!

>>40554457
The horror of how fit her children will be, except for the smart one who keeps her at bay using a ball to play fetch with her

>>40554498
"No, thanks."

"But, Petra, my love! You have to come for a run with me and your brothers! You're so skinny, and your skin's so pale! You'll burn when you go above..."

"I'll wear a robe, mom. Wizards wear robes."

"Wizard? But you're a kobold, and my daughter! You... you should learn to fight and run and... and... Petra, what's that in your hand?"

"Hm? This? I have no idea what you're talking about."

The thin black-furred kobold pup tosses the red rubber ball up and down almost carelessly in her hand, letting it spin before snatching it out of the air deftly. The book in her lap sits, almost forgotten, though a finger marks her place casually. Nadia's eyes followed the sphere up, and down. Up... and down. Her tail wagged despite herself.

"Hm? Oh, mom. You don't want this, do you?" The pup asked almost casually, looking at the ball and not at her mother. Nadia whined softly, muttering "Not fair..." under her breath.

Petra gave a coy sort of smile and turned fully to her mother, patting the book gently. "Well... catch!" She gave it a toss, and Nadia leapt as the pup gave a feint to go high, but tossed it low, bouncing it off the doorway of the cave and out into the warrens. Nadia whined and turned to chase after it.

"Whoops! I guess I'm just not fit or quick enough to go with you after all." She turned to her brothers, then back to her book. The twins shook their heads.

"You're so mean to mom..."

"Don't think I don't love her, but you know what she's like."

File: 1428909568190.png (82 KB, 1275x749)

82 KB PNG

>>40554394
>

>>40554551
I forgot what I was talking about.

There still remains the question of how Nadia will explain how her children look like Kobolds whilst she looks like whatever evolution she is at the end.

"Where's your snout mommy?"

"Oh, I, er, lost it on my adventures."

"Did you ever find it?"

"No."

"... Will I ever lose my snout if I adventure?"

"Only if you stop exercising."

>>40554551
Hahaha, yes. The one Kobold who chases the ball.

>>40554688
That's another question.

All the other RE: Monster protags have been humanoid. What's the hate for playing a more monstrous character?